Sentence examples for containing an shRNA from inspiring English sources

Exact(5)

The miR-30 stem containing an shRNA against firefly luciferase was used as a negative control.

Flow cytometry demonstrated that the cell line containing an shRNA targeting GFP produced an active shRNA, as GFP levels were reduced by approximately 50% (Figure 1B) while Tat-SF1 levels were unchanged (data not shown).

A commercially available lentivirus plasmid vector containing an shRNA insert that does not target human and mouse genes was used to generate controls (Sigma-Aldrich).

Specifically, we stably transfected the cells with a pool of five plasmid vectors, each containing an shRNA targeting a different region of PAX8 cDNA.

To focus on the influence of aSyn on the neuronal differentiation of the patient lines, we neutralized the effects of other genomic variability by generating RNAi SNCA knockdowns from the two clones of SNCA_Tri using transduction with a lentivirus pLKO.1 puro vector containing an shRNA against aSyn mRNA.

Similar(55)

Fig. 7 Construct of pC1301-CX3 or -CX5 containing a shRNA stem loop for rice transformation.

The human cell line 293T received via lipofectamine transfection 7.5 μg of the plp1, plp2, and plp/VSV-G plasmids (Invitrogen, Carlsbad, CA, USA) and 7.5 μg pLKO.1-puro plasmid containing a shRNA sequence targeting the murine ERα (Sigma-Aldrich Corporation, St . Louis MO, USA).

We transplanted lethally irradiated Id1−/− mice with Id1−/− BM that was transduced with a lentivirus vector containing a shRNA targeted against CTSK (shCTSK) (Figure S7A).

Lentivirus particles containing a shRNA were used to infect RCS and COS-7 cells at multiplicity of infection (MOI) of 0.1 to insure that single colonies of integrants could be isolated.

The siRNA sequences used were as follows: BECN1: CCCAGCCAGGAUGAUGUCUACAGAA and GCUAACUCAGGAGAGGAGCCAUUUA. PIK3C3: CAUUGCCGUUAGAGCCACAGGUGAA and GGAGCCUACCAAGAAGGAUAGUCAA. Control: GCUACUCGAGGAGGAACCGUAAUUA. For LV experiments the cells were transduced with virus containing a shRNA plasmid against mBecn1 targeting the nucleotides 405 423 (or against mAtg5) and a GFP-marker.

The pLKO.1-puro non-target shRNA control containing a shRNA (shControl) was obtained from Sigma-Aldrich.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: