Sentence examples for constructs of siRNA from inspiring English sources

Constructs of siRNA were introduced into BM-MSCs by lentivirus.

The pSilencer3.1 (Ambion, Austin, TX, USA) plasmid was used for construction of the constructs encoding siRNA targeting human Capn4, according to the manufacturer's protocol.

CUX1 knockdown was performed by transfecting cells with a pair of siRNA constructs specific for CUX1 mRNA (5′ GAAUCUUCUCGUUUGAAACUUUGAA and 5′ GCUUCAGAGCGAUAAUACACUAUUA) using Lipofectamine2000 (Invitrogen) according to the manufacturer's instructions.

The effectiveness of siRNA constructs to suppress P2Y2- and P2Y4-receptor mRNAs was determined using real-time reverse transcription-polymerase chain reactions (RT-PCR) (see Section 2.6) in rat aortic smooth muscle cells 48 h after nucleofection with siRNA constructs targeting P2Y2- or P2Y4-receptor mRNAs or a NC (non-targeting) siRNA.

TGF- β-sensitive mink lung epithelial Mv1Lu cells were transfected with expression constructs of WOX1 and/or siRNA-targeting TIAF1 (TIAF1si) by electroporation, followed by culturing for 48 h.

For generation of siRNA construct, the GenScript software was used.

Cells were seeded in 35-mm culture dishes and were cotransfected with 0.5 µg of κB-luc or GAL4-luc reporter construct and other constructs as indicated, or 1 µg of siRNA duplexes.

Recovery of siRNA expression constructs from genomic DNA was accomplished by PCR with primers 5'- GandCTCCTCGTTCGACCCCGCCTCGATCC-3' and 5'-GAGCCTGGGGGACTTTCCACACCCTAACTGAC-3'.

The siRNA-resistant/kinase altered Wee1 construct does produce a slight amount of phenotypic rescue (~35%) for both siRNA #6 and #8, but this can be explained by one of two likely possibilities: the K328R change may not produce a fully kinase-dead Wee1 or the over-expressed siRNA-resistant Wee1 constructs may cause some degree of siRNA protection to the endogenous Wee1 mRNA present in the cells.

To know the functional interaction between C/EBPβ and p57 during chondrocyte hypertrophic differentiation, we established two small interfering RNA (siRNA) constructs of p57 for the gene silencing.

These observations suggested that the siRNA constructs of CIAPIN1 could effectively down-regulate the expression of CIAPIN1 and reverse the multidrug resistant phenotype of gastric cancer cells.