Sentence examples for constructed respectively from inspiring English sources

The robust optimisation and deterministic optimisation formulations are constructed, respectively, for comparison.

And two peptides rich in the long alkyl chain and aromatic rings were constructed respectively.

By the given numbers { λ n, α n } ( n ∈ Z ) the functions F 0 ( x, t ) and F ( x, t ) are constructed, respectively, by (14) and (15).

The datasets contain functional magnetic resonance imaging (fMRI) and diffusion tensor imaging (DTI) for each subject, from which brain networks can be constructed, respectively.

Then, by utilizing TRMCEs, the mapping relationships between tool path and the numerical control (NC) command without and with considering the geometric errors are constructed respectively.

In the enhancement stage, prior information on healthy skin is extracted, and the color saliency map and brightness saliency map are constructed respectively.

Mrl2 was amplified with primers mrl2_BstBI_fw (GATAttcgaaATGGCTAGATTGCAATTC) and mrl2_XbaI_rev (CAagatctTTACAAGTCGTCGTCAG) and mrl2_XhoI_fw (GTATctcaga AAAAGATCTATCGGTCCAATCG) and mrl2_XbaI_rev for the native signal sequence and the α-factor construct, respectively.

Transfected samples with either IFNβ101 or IFNβ101+27 have shown 11.55 and 2.26 fold elevation and over-expression compare to the wild type construct respectively.

Bam HI and Not I sites were cloned onto the 3' and 5' end of the cDNA construct, respectively.

We used ORAI1 cDNA and one of the YFP-STIM constructs (STIM1 or STIM2) at 0.4 µg/0.8 µg of DNA per well for each construct, respectively.

For complementation and functional analyses ahk5-1 and ahk5-3 were transformed with a construct expressing the full-length GFP-AHK5 or AHK5-TAP fusion construct respectively under the control of the 35S promoter.