Your English writing platform
Discover LudwigExact(9)
And, despite the message that terrorists have sent us, we continue to maintain and construct targets for their attacks: The Pentagon remains a bull's-eye from the air, as do the office towers recently built around the World Trade Center site.
The control shRNA construct targets human Hsp 70 interacting protein and contained the sequence RHS1764-9500871.
The amiR-CESA4 construct targets AAGGGACCCATTCTTAAGCCA with hybridization energy of −37.74 kcal/mol and the amiR-CESA7 construct targets ACGCCCACCATTGTCATCATC with hybridization energy of −37.37 kcal/mol.
The sh-SOX2 construct targets the 3′-untranslated region of SOX2.
The construct targets exon-2 that is shared among the three major splice isoforms of xaf1 (5'-CCATGGAGGAGCACTGCAAGCTTGAGCAC-3').
This siRNA construct targets genes that are indispensable for cell survival, thus cell death confirmed successful transfection.
Similar(51)
However, the practical applications of PDs (for example, in imaging) require large number of pixels to construct target images.
Silencing fibronectin expression produced similar effects as miR-378a-5p miR-378a-5p miR-378a-5ph a construct targeting miR-378-5p produced opposite results.
The shRNA construct targeting TLR2 was 5'-CCCATGTTACTAGTATTGAAA -3'.
Lentiviral shRNA construct targeting green fluorescnec protein (GFP) was described [46].
To validate the methodology, we used the strategy to construct targeting vectors for Cdh22 and Drapc1 genes.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com