In order to have consistent annotations across all the chromosomes sequenced, the B31 genome annotation was refreshed during this study and now predicts 815 genes in this region, which occupy 93.5% of the chromosome constant region (Accession Nos. AE000783-794 and AE001575-1584).
We believe that the number of loci in the accession is constant – that is, three, the same as in the Col-0 accession – and in several images with fewer than three spots, in those slides the loci lie one over another.
A DNA fragment encoding 309 bp of the mouse IgK constant region (441-750 of nucleotide accession number AF466770) was amplified with the primers 5' GandTCACGTGCTGTATCCATCTTCCCACCATCC-3' and 5'--TCTC GCGGCCGCTGTCTCTAACACTCATTCCTG-3'.
A DNA fragment encoding 901 bp of the mouse IgG constant region (559-1460 of nucleotide accession number AB097849) was amplified with the primers 5' GATATCACGTGTGCCTGGTCAAGGGCTATTTCCCTGAG-3' (restriction site underlined) and 5' CTCC GCTCCCTCCGGGATCTCCTACTCCGAGAGT-3'.
A DNA fragment encoding 901 bp of the mouse immunoglobulin gamma (IgG) constant region (559-1460 of nucleotide accession number: AB097849) was amplified with the primers 5' GandTCACGTGTGCCTGGTCAAGGGCTATTTCCCTGAG-3' and 5' CTCC GCGGCCGCTGGGATCATTTACCAGGAGAGT -3' (restriction sites underlined).
A DNA fragment encoding 309 bp of the mouse immunoglobulin kappa (IgK) constant region (441-750 of nucleotide accession number: AF466770) was amplified with the primers 5' GATATCACGTGCTGTATCCATCTTCCCACCATCC -3' and 5'--TCTC GCGGCCGCTGTCTCTAACACTCATTCCTG-3'.
The CD70-specific human IgG1 antibody 1F6 was cloned with the help of a synthetic gene designed according to the published sequences of the variable domains of this antibody (US 2006/0083736A1) and sequences encoding the constant region of human IgG1 (accession number P01857) and the constant domain of the V-J-C segment of the immunoglobulin kappa chain (accession number AAA59000).
We also found variation in the phase of the conidial banding on the first day of constant darkness across the population of accessions (Figure 2D and 2F).
(fresh weight basis) was determined using three 5-g samples from each accession using the high-constant-temperature oven method (ISTA, 2013).
The role of drivers acting at parcel level was constant between time periods, which suggests that accession to EEC was a strong driver of change.
However, accessions from southern Europe have been found to vernalize at constant temperatures significantly higher than 6°C (Wollenberg and Amasino, 2012), suggesting that accessions from northerly latitudes might vernalize most efficiently at relatively low temperatures.
