Sentence examples for consisting of internal from inspiring English sources

Generally, decision tree is the term for a hierarchical structure consisting of internal nodes and terminal leaves.

These modules are manufactured with several multi-manufacturing sites consisting of internal manufacturing tasks and intermediate outsourcing processes.

The rDNA region consisting of internal transcribed region (ITS) 1, 5.8S subunit and ITS 2 region, was amplified using ITS 1 and ITS 4 primers (Gardes and Bruns 1993).

Nanotubular arrays composed of ZnO and CuO were prepared by ultrasonic spray pyrolysis (USP) and chemical bath deposition (CBD), consisting of internal hexagonal ZnO and external monoclinic CuO shell.

Four treatment groups were tested in this study: (1) nonoperated control (normal), (2) surgical sham consisting of internal fixation without fracture (sham), (3) subcritical fracture (0.6 mm long) consisting of a surgically induced transverse fracture with internal fixation (subcritical), and (4) critical fracture (1.6 mm long; exceeding the local bone diameter) with internal fixation (critical).

To detect FLO11 transcript, a probe consisting of internal fragments of the gene was amplified by PCR with primers of PFLO11CF (CTAGTTCCAAGAGGATCC) and PFLO11CR (CATCAAGCTCTACTACTACTG), complementary to FLO11 sequence.

About 60% of world trade now consists of internal transfers within transnational companies, according to the OECD.

It also consists of internal purifications (e.g., washing out stomach and bowels), shaking the abdomen, and some forms of self-torture.

The documents at issue consist of internal emails and other materials from the Energy Information Administration (E.I.A ., a research agency within the federal Department of Energy.

SA consists of internal and external loops.

These teams don't only consist of internal team members.