Sentence examples for consistent with our design from inspiring English sources

The validation shows that the algorithm is effective and stable, with observed accuracy consistent with our design.

Consistent with our design, in which the Life/Nb antibody pair detects total α-syn, AlphaLISA signals from all the fractions tested were detected using this antibody pair (Fig. 1G for AlphaLISA and Fig. S2F for TR-FRET).

Our analysis shows that such a resonator setup can produce cavity losses consistent with our design requirements and extract a Beam with Propagation Parameter better than 3 mm mrad.

Consistent with our design hypothesis, the F549/F449 ratio increased accordingly with higher [Cys]/[H2S].

The sequence of T α1 ③ gene was consistent with our design as follows: 5′-atgagcgacgccgccgtggacaccagcagcgagatcaccaccaaggaccggaaggagaagaaggaggtggtggaggaggccgagaacagcgacgccgccgtggacaccagcagcgagatcaccaccaaggaccggaaggagaagaaggaggtggtggaggaggccgagaacagcgacgccgccgtggacaccagcagcgagatcaccaccaaggaccggaaggagaagaaggaggtggtggaggaggccgagaactga-3′.

Consistent with our design principle, MAB-0 treatment did not confer detectable photosensitivity onto wild-type GABAARs (Supplementary Figure S2).

We concluded that the synthesized structures were consistent with our intended design and that AFM visualization is a very useful tool for the observation of nanostructures.

Every one of these features suggests that there is reduced VEGF activity in the retina during development, which is consistent with our experimental design that targeted only a subpopulation of cells in the retina.

Consistent with our research design and interest, we did not set out to recruit people with either well or poorly controlled disease.

However, it was not possible to obtain uniformity in the subsample sizes according to age, consistent with our study design, and a major defect of the study was our failure to sample individuals < 17 years old, because the samples were obtained with the voluntary participation of the population, and if children are included, the consent of their parents is legally required.

Consistent with our theorizing, prospective designs yield stronger relationships than retrospective designs, suggesting that safety climate is a better leading indicator than lagging indicator; however, it is clearly both.