Sentence examples for considerable identity from inspiring English sources

The second putative anthranilate synthase gene next to the fmq cluster was termed icsA for its considerable identity to isochorismate synthases in bacteria.

At the amino acid level, it shares considerable identity with sequences of Moloney murine leukemia virus (MoMLV), a prototype MLV.

PknJ kinase domain shows considerable identity with other Mycobacterium STPKs (including maximum identity of 50% with PknF).

Regarding tRNA genes, aligning the annotated genes against the reference genome did not generate considerable identity values for all cases.

The sequences of SAFB1 and SAFB2 share considerable identity and we therefore assessed the specificity of the anti-SAFB1 antibody.

Sequence alignment revels considerable identity between the N-terminal half of their 16 kDa regions, although the C-terminal halves are much less conserved [ 17].

From the homology point of view, CtCHS (GenBank: AFI57883) retains considerable identities to its orthologues in C. chinensis (96%), L. sativa, S. marianum, G. bicolor, R. hirta (95%), Dahlia pinnata (94%), Chrystanthemum nankingense (93%) and A. adenophora (92%).

For example, one 23 nt-long motif (CGTACTTCAGCCTGGGCAACAAG) that shared perfect sequence identity with three adenoviral genomes and considerable identities - with five other adenoviral genomes, was included in a variant of human transposable element of AluS family and was represented in the genome by multiple copies.

In particular, the neck regions align well in structure and contain considerable sequence identity as previously analyzed [9], [11].

Yet, they show a considerable sequence identity of over 40% to ascomycetous laccases.

However, while CDK1 in yeast and insects retains considerable sequence identity with the vertebrate orthologs, much of the conservation of Sin1 is lost.