Sentence examples for consensus forward from inspiring English sources
Analyst Jason Napier said: Standard Chartered's disappointing share performance in 2014 - down 33% in dollars - took consensus forward PE multiples to decade-lows and bank market cap to just $35bn....A tremendous shift in capital allocation is required to get the return on total equity back to 15%, a level below which we don't believe the Standard Chartered business model is sustainable.
Ryland trades at 12.8 times consensus forward estimates, but analysts aren't in any kind of agreement on those estimates.
Two consensus forward primers targeting the BCL1 and BCL2 genes were designed together with a common consensus reverse primer and hydrolysis probe, the latter consisting exclusively of LNA, both targeting the J segments of the immunoglobulin heavy chain (IgH) gene.
The degenerate consensus forward and reverse primers were designed using published sequences of the viral genomes of members of genera Avulavirus, Rubulavirus, Respirovirus and Morbillivirus (accession numbers given below).
The consensus forward primer Beg9 and reverse primer End9 were used to amplify and sequence the VP7 gene.
After that a consensus forward translation was discussed by all health services researchers of our department involved in the process of translation.
"There is emerging bipartisan consensus going forward about how to fix Medicare, but I can't tell you what our budget is going to be because we haven't written it yet".
Egypt is facing daunting economic and social problems, and it needs to find a consensus way forward to build the institutions — judiciary, electoral system, schools — that allow all citizens a say in civic life, protect against autocratic leaders, and adapt and endure over time.
Consensus primers (forward primer: 5′CGCGGCCTATCAGCTTGTTG′3 and reverse primer: 5′CCGTACTCCCCAGGCGGGG′3) were used for PCR amplification of 16S rRNA.
The RNA was subjected to reverse-transcription and amplification using a TaqMan One-Step RT-PCR Master Mix Reagents Kit PE Biosystemss) with DENV-2 consensus primers (forward, 5'-CAGATCTCTGATGAATAACCAACG-3', and reverse, 5'CATTCCAAGTGAGAATCTCTTTGTCA -3') and DENV-2 consensus TaqMan probe (6FAM-5'ATGCTGAAACGCGAGAGAAACCGC -3'-TAMRA).
The methods of assumption, expert opinion and public consensus put forward a list of domains including income, education, health, nutrition, transport, communication, subjective well-being, safety, shelter and water and sanitation, social inclusion and protection.
