Your English writing platform
Discover LudwigExact(4)
The Southern analysis confirmed transformation and also revealed that the number of inserts in different transformed lines varied from one to four.
Using these different genomic DNA isolates as templates, PCR amplification of a fragment of the aphVIII gene confirmed transformation.
Finally, the crystal was cooled to 150 K, after which repeated determinations of the unit cell dimensions confirmed transformation into polymorph 1-B LT.
38, 39 However, inclusion in these trials was based on initial histology, and the presence of contrast enhancement in 60%to70%0% of the patients and the confirmed transformation into anaplastic glioma in over 50% of the operated patients clearly indicates that most patients had a higher-grade tumor and that the observed RRs are in accordance with earlier reports.
Similar(56)
To confirm transformation in T. scotoductus SA1, we compared the total protein pattern of the transformant colonies with that of the parental strain, and also carried out PCR amplification of the nirK gene, which is specific for T. scotoductus SA1.
To confirm transformation in T. scotoductus SA1, we compared the total proteins pattern of the transformant colonies with that of the parental strain, and also carried out PCR amplification of the nirK gene (Primers: Kdir CCGGAGTTTTTATGTACCACTGC Krev GGCCCCACGTTCAGGAAGTA), which is specific for T. scotoductus SA-01.
More specifically, these experiments were carried out to confirm transformation of the carbonaceous substrate into an HS-enriched soil-like material capable of supporting vegetation.
In this study pot trial experiments were carried out to confirm transformation of the carbonaceous substrate, in the presence of a suite of coal degrading fungi and arbuscular mycorrhizal fungi, into a humic-enriched soil-like material in the Cynodon dactylon/coal rhizosphere.
To confirm transformation, the genotype was confirmed by both enzymatic digestion and sequencing.
A patent relating to Agrobacterium-mediated transformation of Impatiens was issued, but no experimental data confirming transformation were reported in the patent [ 19].
Agrobacterium inoculated embryos that remained alive during seven weeks of selection on kanamycin-containing media were tested further to confirm transformation.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com