confirmatory identification

USAGE SUMMARY

The phrase "confirmatory identification" is correct and usable in written English.
It can be used in contexts related to verification or validation processes, particularly in fields like law enforcement, psychology, or research. Example: "The witness provided a confirmatory identification of the suspect during the lineup."

✓ Grammatically correct

Science

Human-verified examples from authoritative sources

Exact Expressions

20 human-written examples

The result of the confirmatory identification analysis was negative, leading to the overall conclusion that no additional substances of interest were present in rubber granulate.

Nature

For all 183 substances, it was checked whether they fulfilled the second prioritisation criterion (classification as CMR category 1A/1B), to see whether additional confirmatory identification and quantitative analysis was necessary.

Nature

For most clinical laboratories, there should be no need to register with the Select Agent Program, as long as suspected isolates of select agents are forwarded to a registered reference laboratory for confirmatory identification and stock cultures of these agents are not maintained.

Clinical Microbiology Newsletter

Confirmatory identification was done by subculturing on Eosin Methylene Blue agar and on MacConkey agar.

Applied Water Science

A small number of live Dipterous larvae and puparia were reared in small vials (larvae were fed rotten minced meat) at room temperature for confirmatory identification purposes.

The Journal of Basic and Applied Zoology

Confirmatory identification of extra ocular sources of infection are reported in 21 100 % of cases in the literature [5, 18, 21].

Journal of Ophthalmic Inflammation and Infection

Human-verified similar examples from authoritative sources

Similar Expressions

40 human-written examples

Confirmatory molecular identification was performed using the MicroSeq™ D2 rDNA Fungal Identification System (Life technologies™, Rotkreuz, Switzerland) [ 16].

BMC Infectious Diseases

Despite their usefulness, current visual, catalytic, enzymatic, and immunologic tests for presumptive and confirmatory tissue identification are applicable only to a subset of samples, might suffer limitations such as low specificity, lack of sensitivity, and are substantially impacted by environmental insults.

Forensic Science International: Genetics

Confirmatory organism identification by conventional biochemical methods and antimicrobial drug susceptibility testing were performed by MDC Hs Bureau of Laboratories (2, 3 ).

Emerging Infectious Diseases

All isolates underwent confirmatory molecular species identification by internal transcribed spacer (ITS) DNA sequencing using the universal fungal primers (ITS1, TCGTAGGTGAACCTGCGG, and ITS4, TCCTCCGCTTATTGATATGC [ 10]) and the online pairwise sequence alignment tool available through the webpage for Centraalbureau voor Schimmelcultures (http://www.cbs.knaw.nl/collections/BioloMICSSequences.aspx).aspx

Antimicrobial Agents and Chemotherapy

Identification and confirmatory testing of B. anthracis were done according to standard microbiologic procedures (5).

Emerging Infectious Diseases

Expert writing Tips

Best practice

When writing about "confirmatory identification", be specific about the methods or criteria used to confirm the initial identification. This adds clarity and credibility to your writing.

Common error

Avoid using "confirmatory identification" without specifying what is being identified and the basis for confirmation. Always provide sufficient context to make the meaning clear. State explicitly the evidence used to support the confirmation.

Linguistic Context

The phrase "confirmatory identification" functions as a noun phrase that denotes the act or process of verifying an initial identification. It highlights the verification stage, implying that a preliminary identification has already been made and is now being substantiated. Ludwig examples show its usage in various contexts, reinforcing its role in validating initial findings.

Expression frequency: Common

Frequent in

Science

100%

Less common in

News & Media

0%

Formal & Business

0%

Ludwig's WRAP-UP

The phrase "confirmatory identification" is a grammatically correct noun phrase widely used in formal and scientific contexts to denote the verification of an initial identification. Ludwig AI affirms its usability. As evidenced by Ludwig, this phrase emphasizes the importance of validation and accuracy, ensuring the reliability of findings across various disciplines. While it is predominantly used in scientific literature, understanding its function and purpose can enhance clarity in writing. Alternative phrases like "validation of identity" or "verification of identification" can be used depending on the specific context.

More alternative expressions

Phrases that express similar concepts, ordered by semantic similarity:

positive identification

General term that can apply to any kind of identification where a match has been made.

verification of identification

Emphasizes the process of verifying a previously made identification.

validation of identity

Focuses on establishing the validity of an already asserted identity.

corroborative identification

Highlights the corroborating evidence that supports the initial identification.

substantiating identification

Focuses on providing substantial evidence to support the identification.

authentic identification

Highlights that an identification is genuine.

definitive identification

Implies a final and unquestionable determination of identity.

conclusive identification

Indicates that the identification is decisive and leaves no doubt.

authoritative identification

Suggests that the identification comes from an authoritative source.

secondary identification

Emphasis on the second step on the identification.

FAQs

How is "confirmatory identification" used in scientific research?

"Confirmatory identification" is often used in scientific research to validate initial findings or identifications, ensuring the accuracy and reliability of results. This can involve using multiple methods or tests to confirm the presence or identity of a substance or organism.

What's the difference between initial identification and "confirmatory identification"?

Initial identification is the first step in determining the identity of something, while "confirmatory identification" is a subsequent step that aims to validate the initial finding. "Confirmatory identification" provides additional evidence to support the accuracy of the initial identification.

When is "confirmatory identification" necessary?

"Confirmatory identification" is necessary when the initial identification may be uncertain or when high levels of accuracy are required, such as in medical diagnoses, forensic science, or environmental monitoring. It's always useful in situations when is important to double check something.

What are some alternative terms for "confirmatory identification"?

Alternatives to "confirmatory identification" include "validation of identity", "verification of identification", or "corroborative identification", depending on the specific context.