Sentence examples for confirmation of integration from inspiring English sources

Exact(3)

Confirmation of integration of heavy and light chains into P. pastoris.

Primers designed to the hygromycin phosphotransferase gene (hpt) of pHB for confirmation of integration are 5' TAGGAGGGCGTGGATATGTC 3' and 5' TACACAGCCATCGGTCCAGA 3' (GenBank accession No. E00777).

After confirmation of integration of the targeting vector by Southern blot, positive ES cells were expanded and injected into blastocysts, which were then implanted in pseudopregnant females (C57BL/6), and chimeras were bred to obtain germline transmission.

Similar(57)

Two candidates were selected from a collection of 90 G418-resistant clones, based on growth and confirmation of genome integration.

Confirmation of stable integration up to 93 passages was indicated by performing PCR amplification on several passages of pXL NeoGag in Sf9 cells (see bold font).

A single clone that was PCR-positive for both the left and right arms of the predicted integration event was expanded to 24-well plates, and eventually to 100 mm dishes, to generate sufficient cells for the preparation of genomic DNA and Southern blot confirmation of the integration event.

CGH analysis supported by PCR confirmation of phage integration sites revealed that all CC133 strains had either a complete ΦSaov1 (n = 9 of 13) or related phage element (n = 4 of 13) and CC151 strains all contained a distinct but related phage element (fig. 3) consistent with the identification of a remnant phage in the genome of the ST151 strain RF122 (Herron-Olson et al. 2007).

Confirmation of the predicted integration events by diagnostic PCR fragments, tests 1 4 (see Fig. 3A).

Confirmation of the single integration event of the pC-P54::MeCu/ZnSOD-35S::MeAPX2 T-DNA in these transgenic lines were carried out by the Southern blotting technique using XbaI-digested cassava genomic DNA, which were extracted from leaves of in vitro plants and hybridized with DIG-labeled HPT probe.

PCR confirmation of the 60-mer integration allele was performed using primers flanking the target site.

Our finding that MLV insertions from PBL-GT showed a strong preference for 'immune functions' genes and a lower contribution of categories unrelated to haematological/immune system was a first confirmation of a cell-dependent integration profile.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: