Sentence examples for condition as above from inspiring English sources

The same specific primer and thermocycling condition as above were used.

For blocking experiments using cytokine-specific mAbs, the same condition as above was used except for the addition of anti-IFN γ mAb (5  μg/mL) to neutralize IFN- γ.

Primers (panD_F: 5'TCandGGTTCCGGTCGGCTGCT3' and panD_R: 5'TATCCGCCACTGCTGCACGACCTT3') were used to amplify a 650 bp PCR product that contains the whole panD gene from PZA-resistant M. tuberculosis strains using the same condition as above for amplifying the pncA gene.

We used the same inclusion condition as above with regard to employment status at the starting date 1 January 1994, and we added the conditions that a person had to be at least 30 years old and employed as a seaman or fisherman some time during 1993 (the year preceding the baseline date).

On the other hand, addition of 4 mol% of KF to the melt led to larger cathodic current in cyclic voltammogram, and gave a dense, adhesive and thicker metal film of ca. 3 μm thickness in the same electrolysis condition as above.

Then the RD cells were treated with inhibitors for 8 h and infected with Virus-P2 virus at the same condition as above.

Water samples were analyzed using the standard addition method under the same batch conditions as above.

Mixtures were then allowed to be stirred for 2 h at 25°C under the same batch conditions as above.

The juveniles were then maintained under similar conditions as above.

For Fos protein analysis, mice were handled and conditioned as above.

Cycling conditions were as above but with annealing temperature raised to 50°C.