Sentence examples for comprised forward from inspiring English sources
Based on international standards, the translation strategy comprised forward translations, reconciliation, backward translation and pre-testing steps.
The first step comprised forward translations from English to Farsi by two independent bilingual translators who were not health professionals; minor differences were accommodated.
The procedure comprised forward translation, assessment of item comprehension, back-translation into English, and development of a consensual version based on the results of the previous translations and comprehension assessments.
The procedure comprised forward translation, assessment of item comprehension, back translation to English and development of a consensual version based on the results of previous translations and comprehension assessments.
Three examples are shown in Fig. 6: BmHel-6 was formed from forward-oriented segments of BmHel-7 and BmHel-8; BmHel-9 comprised forward BmHel-7 and reverse BmHel-8 segments; and BmHel-10 united forward segments of BmHel-7 and dBmHel-11.
Two evolutionary transition rates comprising forward (from presence of expression to absence of expression) and reverse transition (from absence of expression to presence of expression) were used for estimating the character transition rate.
England defence coach Mike Ford told BBC Radio 5 live that it was "inevitable" that Johnson's backroom team - which also comprises forwards coach John Wells, scrum coach Graham Rowntree and attack coach Brian Smith - would change once a replacement as manager took over.
It is mostly comprised of forward and backward bending movements, often with some lunges to balance out the routine.
The primer-probe set targeting the bacterial 16S rDNA gene comprised of forward primer 16S-F1 (5'-CGA AAG CGT GGG GAG CAA A -3'), reverse primer 16S-R1 (5'-GTT CGT ACT CCC CAG GCG G-3') and probe 16S-P1 (FAM- ATT AGA TAC CCT GGT AGT CCA –MGB).
These comprised a forward primer complementary to the chromosome and a reverse primer specific to a plasmid encoded region.
The assay comprised a forward primer (GCACAGAAAATGCCAGAATG), reverse primer (AGGTGAACCGACATGAAACC) and two allele-specific probes (FAM-CTACCCGCCTGG CTGGGATAT-BHQ-1) and (HEX-CTACCCGCCTGG TTGGGATAT-BHQ-1).
