Sentence examples similar to complimentary targets from inspiring English sources

Similar(60)

using methylene blue (MB) redox indicator at 25 °C was achieved using ssDNA-GNAs-ITO bio-electrode to detect the complimentary target sequence (5'GGCGGCGGGCGTCGCGCACG 3') through differential pulse voltammetry (DPV) and electrochemical impedance spectroscopy (EIS).

Finally, the effects of low power microwave heating on the ability of DNA to re-hybridize with the complimentary target on the surface gold films, which allows the multiple re-use of the gold films, is demonstrated.

One protein identified was Argonaute-2 (Ago2), which mediates RNA-induced gene silencing through binding small RNAs and promoting degradation of complimentary target mRNAs.

Furthermore, clear distinction in complementary and non-complimentary targets was obtained by EIS studies for genomic DNA in culture spiked biological fluids 'CSBF' (blood and urine).

The ability of the immobilized ssDNA molecules to bind with complimentary RNA targets was confirmed via field-emission scanning electron microscopy and energy-dispersive X-ray spectroscopy-based analysis of quantum dots bound to the ssDNA/RNA hybrids formed on the surfaces of the biofunctionalized CNF-tipped SPM probes.

To find out how many of the SSH detected genes with probes on the GeneChip microarrays can actually be detected by the Affymetrix technology, we used the subtracted cDNA to synthesize labeled complimentary RNA (cRNA) targets for the GeneChip microarrays.

Thirdly, a truncated sgRNA with less than 20 nucleotides complimentary to a target region would dramatically reduce the off-target effects by 5000 fold, without scarifying target efficiency [ 115].

miRNAs are a set of noncoding RNA sequence of 19 to 25 nucleotides that play a major role in regulating gene expression by degrading its target coding mRNA and by repressing protein translation through partial or complete base pairing to its complimentary sites on target mRNA [ 31]. miR-125b and miR-504 were described as bona fide negative regulators of p53 in human cell lines [ 32, 33].

The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure.

Under this conformation, the fluorescence of the MB is "switched OFF" while upon hybridization of the loop sequence with a complimentary nucleic acid target, the hairpin stem-loop structure opens up, thus separating the quencher from the fluorophore and the fluorescence is "switched ON".

It is an intriguing possibility that N1L and F1L target complimentary sets of Bcl-2 proteins, although functionally N1L is not sufficient to inhibit the extensive Bad-dependent cell death induced by the ΔF1L/VGF virus.

Show more...

Your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: