Sentence examples for complimentary target from inspiring English sources

using methylene blue (MB) redox indicator at 25 °C was achieved using ssDNA-GNAs-ITO bio-electrode to detect the complimentary target sequence (5'GGCGGCGGGCGTCGCGCACG 3') through differential pulse voltammetry (DPV) and electrochemical impedance spectroscopy (EIS).

Finally, the effects of low power microwave heating on the ability of DNA to re-hybridize with the complimentary target on the surface gold films, which allows the multiple re-use of the gold films, is demonstrated.

One protein identified was Argonaute-2 (Ago2), which mediates RNA-induced gene silencing through binding small RNAs and promoting degradation of complimentary target mRNAs.

Furthermore, clear distinction in complementary and non-complimentary targets was obtained by EIS studies for genomic DNA in culture spiked biological fluids 'CSBF' (blood and urine).

The ability of the immobilized ssDNA molecules to bind with complimentary RNA targets was confirmed via field-emission scanning electron microscopy and energy-dispersive X-ray spectroscopy-based analysis of quantum dots bound to the ssDNA/RNA hybrids formed on the surfaces of the biofunctionalized CNF-tipped SPM probes.

Thirdly, a truncated sgRNA with less than 20 nucleotides complimentary to a target region would dramatically reduce the off-target effects by 5000 fold, without scarifying target efficiency [ 115].

The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure.

Under this conformation, the fluorescence of the MB is "switched OFF" while upon hybridization of the loop sequence with a complimentary nucleic acid target, the hairpin stem-loop structure opens up, thus separating the quencher from the fluorophore and the fluorescence is "switched ON".

It is an intriguing possibility that N1L and F1L target complimentary sets of Bcl-2 proteins, although functionally N1L is not sufficient to inhibit the extensive Bad-dependent cell death induced by the ΔF1L/VGF virus.

Target complimentary DNAs were amplified using SYBR Green Supermix with ROX (6-carboxy-X-rhodamine; Fermentas) on a Mastercycler ep Realplex instrument (Eppendorf, Hamburg, Germany) at the following thermal cycling conditions: 95°C for 10 min followed by 40 cycles consisting of 95°C for 15 s denaturation, 60°C for 30 s annealing and 72°C for 30 s extension.

To find out how many of the SSH detected genes with probes on the GeneChip microarrays can actually be detected by the Affymetrix technology, we used the subtracted cDNA to synthesize labeled complimentary RNA (cRNA) targets for the GeneChip microarrays.