Sentence examples for complementary reversed from inspiring English sources

Furthermore, the corresponding in silico tags of complementary reversed antisense sequences of deposited ESTs called "3'-reads" were also extracted and named R1cr, R2cr, or R3cr in the presence of a polyadenylation signal and poly(A) tail.

Basically, the optimal N-map of a sequence s over a sequence t is the best way of partitioning the first sequence into N parts and placing them, possibly complementary reversed, over the second sequence in order to maximize the sum of their gapless alignment scores.

Let a promoter be denoted now as S = (S',S″), where S' and S″ are the forward and complementary reverse strands.

A complementary reverse genetic application is the temporal and spatial controlled over-expression of genes using the Gal4-UAS [8] and the mifepristone-inducible LexPR system [9].

For the introduction of the K557R, D591V and K617A mutations the following forward mutagenic primers were used: 5'-CCTGTGACCGCATCAGGCAGTCAGCAGCTGG-3', 5'-GGACTGGCAGCTGGGGCCGTCGCTGCCTACATTTTTGAG-3' and 5'-GAACATCTGGTGCAAAAGATGGCCACAACTGTGAAAAGGGGCTTG-3'; for reverse primers, the complementary reverse oligonucleotides were used.

Complementary reverse strands were also ordered.

The coding frame of Populus homologues follow the proposed strand or the complementary reverse one.

To calculate the enrichment of different 8-mers, we first generated the unique 32,896 8-mers by ignoring the complementary reverse 8-mers.

An oligonucleotide probe from the mouse Bdnf promoter region 5′ AAGCATGCAATGCCCTGGAA CG GAATTCTTCTAATAAAAGATGTATCATTTTAAATGC 3′ (Biocore), plus complementary reverse strand, was methylated or unmethylated at the central CG indicated in bold italics.

A blast of each sequence against i) itself and ii) its complementary reverse using the program Blast 2 Sequences [ 65] was used to detect inverted repeats (IRs), direct repeats (LTRs), and palindromes within the sequences.

In the case of the unique dinucleotide repeats, the most abundantly reported motif was GAn (including complementary, reverse, and reverse-complementary permutations: CT, AG, and TC in descending order of frequency), accounting for approximately 34% of all motifs in the data set and 66% of all dinucleotide repeats.