complementary of

USAGE SUMMARY

The phrase 'complementary of' is not proper English.
To express the same idea, you can use the phrase "complementary to", as in: The colors green and purple are complementary to each other.

⚠ May contain grammatical issues

Science

News & Media

Formal & Business

Human-verified examples from authoritative sources

Exact Expressions

60 human-written examples

"We were very complementary of each other," Johnson said.

The New York Times - Sports

The complementary of any colour is its direct opposite on the colour wheel.

The Guardian - Arts

Harmony means complementary of natural and man-made cycles.

Journal of Cleaner Production

Using cadmium yellow and cadmium red, mix an orange that is the complementary of pure cobalt blue.

The Guardian - Arts

Online and in-person book clubs can in theory be complementary, of course.

The New York Times

The complementary of a colour is simply the colour opposite it on the colour wheel: red-green, yellow-violet, blue-orange.

The Guardian - Arts

HCV107-151 negative strand including the sequence corresponding to the inverse complementary of the T7 promoter was obtained from Eurofins Genomics SAS (GCAGCCTCCAGGACCCCCCCTCCCGGGTGTGCCATAGTGGTCTGCCCTATAG TGACTCGTATTA).

Nature

Steve cogently argues that when you break out PISA results by race — a somewhat arduous task — the results are highly complementary of the US education system.

University of California, Berkeley

Accordingly, a dodecamer polydeoxythymidylic acid having ferroin-moiety (T12FeP) and a ferrocene-modified complementary of K-ras (KrasFc) were synthesized.

Journal of Electroanalytical Chemistry

Final results confirm the complementary of TSP and SSP, and our multi-cue representation TSP + SSP + BoVW can properly describe human actions with large intro-variability in real-time.

CAAI Transactions on Intelligence Technology

HS provide data from the general population which is complementary of that obtained through other procedures and takes into account the various dimensions and connections of health and health system.

Medicina Clínica

Expert writing Tips

Best practice

Always use "complementary to" instead of "complementary of" to maintain grammatical accuracy in formal writing.

Common error

Avoid using "complementary of", a common error arising from the similar structure of other prepositional phrases. Remember that the correct form is "complementary to".

Linguistic Context

The phrase "complementary of" functions as a prepositional phrase, typically intended to describe a relationship of mutual enhancement or completion between two entities. However, it's grammatically incorrect, as Ludwig AI suggests.

Expression frequency: Very common

Frequent in

Science

39%

News & Media

33%

Formal & Business

28%

Less common in

Encyclopedias

0%

Wiki

0%

Reference

0%

Ludwig's WRAP-UP

The phrase "complementary of" is frequently used, but it's grammatically incorrect. The correct phrase is "complementary to". As Ludwig AI indicates, while the examples show intent to describe mutual enhancement, always use "complementary to" in formal writing. The intended purpose of this phrase is to show that things enhance or support each other. Although prevalent in Science and News & Media, correctness should always be prioritized.

More alternative expressions

Phrases that express similar concepts, ordered by semantic similarity:

complementary to

Replaces "of" with "to" to adhere to standard English grammar, creating a correct prepositional phrase.

supplemental to

Indicates that something adds to or enhances something else, focusing on addition rather than inherent matching.

supportive of

Highlights the aspect of providing assistance or reinforcement.

harmonious with

Emphasizes the balance and agreement between elements.

compatible with

Focuses on the ability of things to coexist effectively.

integrates with

Describes how different parts combine to form a whole.

works well with

Implies a practical and functional compatibility.

pairs well with

Suggests a combination that enhances both elements, often used in culinary contexts.

enhances

Implies that something improves or augments something else.

a complement to

Functions as a noun phrase to indicate that something completes or enhances something else.

FAQs

What's the correct phrase, "complementary of" or "complementary to"?

The correct phrase is "complementary to". "Complementary of" is grammatically incorrect.

How can I use "complementary to" in a sentence?

Use "complementary to" to describe how two things enhance each other. For example, "The skills of the two team members are complementary to each other".

What are some alternatives to "complementary to"?

Alternatives include "supplemental to", "supportive of", or "harmonious with", depending on the specific nuance you want to convey.

Is "complementary of" ever correct in English?

No, "complementary of" is not a standard or grammatically correct phrase in English. The correct phrasing is always "complementary to".