Your English writing platform
Free sign upSimilar(60)
As a result of the inversion, the 8 bp sequence now exists in inverse complementary orientation with each site flanking different copies of the LCR, as expected (e.g., Figure 3 of [36]).
HCV107-151 negative strand including the sequence corresponding to the inverse complementary of the T7 promoter was obtained from Eurofins Genomics SAS (GCAGCCTCCAGGACCCCCCCTCCCGGGTGTGCCATAGTGGTCTGCCCTATAG TGACTCGTATTA).
It has been suggested that the coding for a ligand and its receptor may have originated in inverse complementary strands of the same DNA.
We review the recent progress in systems modelling and omics analysis of the heterocellular heart environment through complementary forward and inverse approaches, illustrating these conceptual and experimental frameworks with case studies from our own research program.
where erfc−1 is the inverse complementary error function.
The downconverter performs the complementary operations in inverse order, i.e., I/ Qdemodulation, filtering, and downsampling.
These techniques include operations like insertion, deletion and node label substitution [19] with costs defined to transform one tree to another to enable the computation of a distance (which is complementary to, or inverse of, similarity).
Here, z_HR = −sqrt(2) * erfcinv(2*HR), where erfcinv is the inverse complementary error function.
Such a palindromic sequence consists of two inverse complementary sequences for the stem, at a physical distance representing the loop of a putative hairpin.
As SOD runs like a mirror image to the horizontal compared to GSH-PX and catalase, the inverse (complementary value to 1) of the Rf-value has been used in the overall model for SOD.
ICR: Internal Complementary Region; ITR: Inversed Terminal Repeat; lE: left Extension; LINE: Long Interspersed Element; LTR: Long Terminal Repeat; lTer: left Terminus; MT: MethylTransferase; rE: right Extension; RH: RnaseH; RT: Reverse Transcriptase; rTer: right Terminus; SDR: "Split" Direct Repeat; SINE: Short Interspersed Element; YR: Tyrosine Recombinase.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.
Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com