Sentence examples for complement using the from inspiring English sources

We assessed each CNV-mediating HERV element for matches to the motif's position weight matrix and its reverse complement using the Biostrings package.

We started with the chromosomal evolution hypothesis of strawberry and peach elaborated by Vilanova et al. [ 28], modified it with the new data provided by this research, and then constructed the apple chromosome complement using the more complete Prunus- Malus comparison mainly.

Plasmid pCMV/myc/mito- hOGG1 (MTS- hOGG1) was then used to generate a mutant at amino acid position 229, by changing CGA (Arginine) to CAA (Glutamine) using primers 5' CTGGCTGCAGCAGCTACAAGAGTCCTCATATGAG 3' and its reverse complement, using the site directed mutagenesis kit (Stratagene, La Jolla, CA).

Then the BNA results have been calibrated against and complemented using the residual stress values measured using X-ray diffraction.

These newly engineered mutant strains, PAO1-fadD1::FRT, PAO1-fadD2::FRT, and PAO1-ΔfadD2D1::FRT, were complemented using the relevant gene(s) on the miniCTX2 single copy integration vector as described previously [56].

JN24.6 was complemented using the same vector by performing cotransformation with the hygromycin resistance gene-containing plasmid pAN7.1.

This approach was complemented using the available protostome and Ciona EST data to identify putative N and C terminal ends of the protein (Additional file 1).

Minimal sample work-up was required and the results obtained by ELISA were further complemented using the LC-MS/MS method.

Therefore, complement inhibition using the humanized anti-C5 monoclonal antibody eculizumab could be a rational treatment.

These 10 individual patient sera samples were analyzed for their capacity to induce complement activation using the high-throughput bead-based C3d assay (Immucor, (43)).

Thus, IgG class antibodies have a greater affinity in the cELISA, while IgG2 subclass antibodies are unable to fixate complement used in the CFT.