Sentence examples for complement of a sequence from inspiring English sources

It should be noted that calculation of the number of subclasses in major classes takes into account both direct and inverse complement of a sequence in the proximal-8 region to eliminate those subclasses that seem to represent two different sequences but in fact are direct and inverse complement versions of the same sequence.

If the BES match was from the reverse complement of a sequence a "-" notation was made.

Reads are mapped in the color space where the reverse complement of a sequence is the same as the reverse, because the complement of a color is itself.

The hairpin structures form because two of the primers used contain, at their 5' end, a reverse complement of a sequence that is present in the target further downstream of the initial binding site.

In theory, the technique is simple yet elegant: the complement of a target sequence of messenger ribonucleic acid (mRNA) encoding the protein of interest is used to disrupt translation or prevent translation initiation.

Using a graphically-designed set of nucleic acid symbols [ 10] we showed that when one represents complementary nucleotides using the same ambigram, it is possible to derive the complement of an entire sequence by simply rotating the text 180 degrees.

We defined a qualified siRNA r′ as the reverse complement sequence of a qualified sequence.

MMP-2 shRNA contains a complement of a 21-nucleotide sequence (tgtgctgaaggacacactaaa, GenBank NM-004530), which was separated by a 7-nucleotide non-complementary spacer (CCACACC).

The cross structure present within the conserved element is due to a match to the reverse complement of a 39-bp sequence that forms an imperfect palindrome near the beginning of the conserved 97-bp core (Fig. 4E).

This is because the reverse-complement of a coding sequence has a slightly higher G C content and contains fewer stop codons than typically occur in UTRs, therefore these regions are often a closer match to the coding sequence model.

Gene imaging can be achieved using a modified radiolabeled antisense oligodeoxynuclide coded with the complement of the sequence of a single strand of DNA or mRNA.