The DNA sequences used as probe or as cold competitor are the following (mutations are shown as lowercase letters): 5′- AGAATCAGACATCTGTTCTGA ATGACA −3′, 5′ T GTCATTCAGAACAGATGTCTGATTCT-3′ (ARE); 5′- AGA ATCAGACATCTaccCTGAATGACA-3′, 5′- TGTCATTCAGggtAGATGTCTGATTCT −3 (mutated ARE).
Carlsberg, a Danish beermaker, and Heineken, a Dutch competitor, are also struggling to revive revenue growth in Western Europe.
The "what ifs?" are plentiful only because the statistics of Seles' dominance – even with Graf as her fiercest competitor – are undeniable.
What kind of competitor are you when you play video games? A. Mentally, when I play a video game, I don't want to lose.
Verizon has sold bits of its landline businesses in three states and is negotiating to do the same elsewhere.Nonetheless Verizon and AT&T, its main competitor, are still mostly "wireline", says Craig Moffett, an analyst with Bernstein Research.
For instance, when the interspecific effects of each species upon the abundance of its competitor are approximately equal, the species with the higher initial abundance is likely to drive the species with a lower initial abundance to exclusion.
My colleague Brian Stelter reported today in The Times that firms such as Time Warner Cable, which don't want to lose customers to a new competitor, are pressuring media companies to not give their content to Intel.
In effect, AT&T and Verizon Wireless, AT&T's chief competitor, are set to swap strategies in the high-stakes smartphone market, with AT&T turning to Android and Verizon to the iPhone.
