Sentence examples for compatible with multiple from inspiring English sources

The program is actually compatible with multiple types of codes, ensuring international compatibility.

He added that making the app compatible with multiple operating systems and social networks helps safeguard Flipboard from competitors.

StatMarket has been tracking browser use since late 1998, primarily marketing the data to Web developers who invest time and money to make features on Web pages compatible with multiple browsers.

The audio systems are compatible with multiple formats including CD-R/CD-RW, MP3 and WMA.

The software was compatible with multiple platforms (e.g., Unix, Linux and Windows).

In typical cases, the evidence is logically compatible with multiple hypotheses, including hypotheses to which it lends little inductive support.

It is clear that any waveform for the next generation of mobile communication systems need to be compatible with multiple-input multiple-output (MIMO).

The challenges of future wireless networks imply that the physical layer of the next generation mobile communication system needs to be compatible with multiple-input multiple-output and allow a flexible multiple access scheme.

To design new proteins that can switch conformation, protein designers have focused on the two key components of protein switches: the amino acid sequence must be compatible with the multiple target states and there must be a mechanism for perturbing the relative stability of these states.

The advantage of using Rf is that it is compatible with the multiple hypotheses model of SNP-based testing, which was effective in our previous study [ 18].

The primers used for PCR, GGGGTACC TGCACCCAATCCACACCCACTAAGA (forward) and CGGG ATCCACTGTCAAGGCGCAAATCCAGCAA (reverse), contain Kpn1 and BamH1 sites, respectively, which are compatible with the multiple cloning sequence in pGLII.