Your English writing platform
Free sign upSuggestions(1)
Exact(1)
Levels of mRNA were then standardized against 18s rRNA levels with primers 18SF: 5' CCCCTCGATGCTCTTAGCTGAGTGT 3' and 18SR: 5' CGCCGGTCCAAGAATTTCACCTCT 3', taking into account a previous determination of 65 hours for 18s rRNA half life [95], and plotted as the percentage of remaining mRNA compared to message levels at the 0 time point (where there is a 100% maximum mRNA level).
Similar(59)
We also expected that messages in single-paragraph format would lead to longer off-road glances compared to messages parsed by sentence because the former lacks natural breaking points, which may motivate drivers to read more information per glance.
Messages two and three did increase the number of salad choices when compared to the message one condition.
This property is required as the messages to be encrypted in this paper are from a very small range compared to the message space of the cryptosystem.
Compared to popup message windows in the Gmail version, the widget's conversations open up tabs instead.
Asymmetric cryptography is slow (computationally intensive), but not too slow to encrypt such a small (as compared to secret message) bits as a symmetric encryption key.
As shown in Figure 14b, such overhead is much lower compared to the message list included in beacons, since it depends only the number of neighbors participating in the rebroadcast operation defined by AMD's suppression technique.
This is an ironic sentiment when compared to his message in the poem "To Science" where he shows a distaste for modern science encroaching on spirituality and the artist's imagination.
When compared to Stormfront message boards and other online neo-Nazi havens, The Base is more curated, a mix of chat server and matchmaking site where group members need to be vetted to get in, and are paired geographically for paramilitary activities.
Compared to static message translation between different specifications, this approach well integrates with the distributed architectures and does not need to perform costly operations such as parsing and message construction.
The suitable solution to eliminate these drawbacks is to offer the available bandwidth to the transmitter node whose message holds the highest priority compared to the messages of its neighbors.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.
Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com