Calculation of cell number was determined based on real-time PCR for gene encoding eukaryotic18S rRNA (Hs99999901_s1, Taqman, Applied Biosystem) with common sequence for human and mouse.
Furthermore, HLA-B*45 involvement suggests that the common sequence for the antigen group may anchor parasite peptides and trigger a protecting response.
We did not examine miR-133b because it was considered to function similarly to miR-133a; these microRNAs have very similar sequences (miR-133a: UUGGUCCCCUUCAACCAGCUGU, miR-133b: UUGGUCCCCUUCAACCAGCUA) and have a common sequence for binding to FSCN1 mRNA (UUGGUC).
In addition, these primers also contain 15 20 nucleotide common sequences that contain sites for restriction enzymes for cloning of the PCR products into the YTH screen vectors (pGADT7 and pGBKT7) and the mammalian expression vectors (pCMV-HA and pCMV-Myc) (Supporting Information Table S1).
The nucleotide sequence for diverse blaCTX-M genes was aligned in a search for common sequences.
Additionally, only some of the common sequences would be amenable for the design of therapeutic tools.
The amino acid sequences of all three sesquiterpene synthases contained the common sequence motifs for the sesquiterpene synthase family [ 45], such as the highly conserved DDxxD and RxR motifs, responsible for the divalent metal ion-substrate binding.
The sequence grouping and alignment illustrated in figure 1 outline the evolutionary context of the Ago family, revealing the common sequence requirements for the structure and function of the mid domain fold.
For dissectHMMER, the preceding finding necessitates for a scoring method that normalizes for the differences in false-positive rates generated by HMMER2 and HMMER3 when unifying overlapping (i.e. common sequence coverage for the same domain model) sequence-to-domain hits between HMMER2 and HMMER3.
In fact, C3H, the only strain examined in common with the current study and previous work performed by Southern blot looking at specific ERV integrations while demonstrating some common sequences, contrasted in several cases for Pmv, Mpmv and Xmv elements.
