Sentence examples for common sequence for from inspiring English sources

Calculation of cell number was determined based on real-time PCR for gene encoding eukaryotic18S rRNA (Hs99999901_s1, Taqman, Applied Biosystem) with common sequence for human and mouse.

Furthermore, HLA-B*45 involvement suggests that the common sequence for the antigen group may anchor parasite peptides and trigger a protecting response.

We did not examine miR-133b because it was considered to function similarly to miR-133a; these microRNAs have very similar sequences (miR-133a: UUGGUCCCCUUCAACCAGCUGU, miR-133b: UUGGUCCCCUUCAACCAGCUA) and have a common sequence for binding to FSCN1 mRNA (UUGGUC).

However, when we analyzed 58 common sequences for all the four loci with at least three accessions per species, the proportion of species recovery increased with ITS and trnH-psbA.

The amino acid sequences of all three sesquiterpene synthases contained the common sequence motifs for the sesquiterpene synthase family [ 45], such as the highly conserved DDxxD and RxR motifs, responsible for the divalent metal ion-substrate binding.

The sequence grouping and alignment illustrated in figure 1 outline the evolutionary context of the Ago family, revealing the common sequence requirements for the structure and function of the mid domain fold.

For dissectHMMER, the preceding finding necessitates for a scoring method that normalizes for the differences in false-positive rates generated by HMMER2 and HMMER3 when unifying overlapping (i.e. common sequence coverage for the same domain model) sequence-to-domain hits between HMMER2 and HMMER3.

pcb#2 contains unique 3' sequence immediately after the cob repeat, whereas pcb 7 contains additional common sequence with pc3#2.2 for ~1 kb before unique sequence occurs.

These results indicate that the common sequence element is important for PTEN promoter activity as it is for miR-22 promoter activity.

The promoter analysis tools in Chipster offer a possibility to search for common sequence motifs with Weeder [ 27] or Cosmo [ 28], or search for known transcription factor binding motifs using the JASPAR matrices [ 29].

We searched in breakpoint regions for common sequence motifs.