Sentence examples for common primer forward from inspiring English sources

Two positive controls were designed for each SNP, to include allele-specific target sequence (without the addition mismatch) and the common primer (forward or reverse as appropriate), to test the ability of the assay to identify the SNP (Table  9).

The BRAF V600E/wildtype duplex TaqMan assay used common primers (forward) 5′-CTACTGTTTTCCTTTACTTACTACACCTCAGA-3′, (reverse) 5′-ATCCAGACAACTGTTCAAACTGATG-3′, and specific probes (BRAF V600E) 6FAM-TAGCTACAGAGAAATC-MGBNFQ and (wildtype) VIC-CTAGCTACAGTGAAATC-MGBNFQ.

For each INDEL marker, one common primer (CP and twoo forward primers were designed: one inside (IN) and one outside (OUT) the deletion (Table 3).

In the next step, quantitative RT-PCR was performed in presence of Express Syber GreenER (Invitrogen) using the following primers: common forward primer 5′-aataaatcataaggccgtcatggtggcgaataa-3′ in combination with either L reverse primer 5′-aataaatcataatcgaaaacgacttccatgtct-3′ or 1D reverse primer 5′- aataaatcataacctcttctccccctttgtgt-3′ to detect L or 1D region respectively.

Where CP = Common Primer; inv = Inversion; F = Forward; R = reverse These MAMA were used to analyze several isolates within the Vollum branch.

Nineteen specific forward primers and a common primer annealing in the β-chain constant (Cβ) region were designed to amplify all Aotus Vβ families reported to date [11].

Multiplex PCR using genomic DNA as template was performed with a combination of three primers: a common forward primer located upstream of Hoppel insertion (Indy-hoppel±1S: 5'-CTACATTGTATACGGAGACATTCG G-3'); two reverse primers, one inside Hoppel (Indyhoppel+3A: 5'-CCATGTAAATTCGTTTCTTCGATC-3') and the other downstream of Hoppel (Indy-hoppel−1A: 5'-CATCTTTCGTCTTGCTATCAGCA-3').

This allows designing common primers for PCR, for examples, the forward and reverse primers for all font images now commonly contain gTCTTg and gTCTT, respectively.

Primers: F, forward primer; R, reverse primer Primers: F, forward primer; R, reverse primer.

Genotyping of Bcl-G-deficient mice was performed using a three-primer PCR reaction using a common forward primer (5′-TCCGTCCCATTATAACCCTA-3′), together with two reverse primers (5′-CTGGAACGACAGAGGGCAAA-3′ and 5′-TTACCATCACAGAGCCAGAA-3′).

SNP rs761142 was genotyped using allele specific PCR (common forward primer: CAACAGTTGGTTCTAGCAAAAGGA; reverse primer for reference allele: CCACACTGCTGGCTCTCTTGTAA; reverse for variant allele: CCACACTGCTGGCTCTCTTGTAC) as described [ 47].