Your English writing platform
Discover LudwigExact(1)
Hydrocortisone 20 milligrams twice daily was commenced with the second injection of goserelin.
Similar(59)
The analysis commenced with the first and the second author reading and annotating each transcript individually.
Timing with a digital stopwatch commenced with the first footfall and stopped with the subject's first footfall after crossing the 6-meter end line.
Professional education for health practitioners is a continuum which commences with the first year professional school until the cessation of a professional career.
By late September, the buildup the Smits' departure was set to commence with the first episode of season 6, on October 20.
Eligible women were randomly assigned to receive either 4 mg intravenous ZOL every 3 weeks for 1 year (total 17 doses) commencing with the first dose of chemotherapy, or no ZOL (chemotherapy alone; Figure 1).
The third genetic sequence (SEQ III) commenced with the highstand system tract (HST) from 11,957.49 to 10,715.73 ft.
98.3% of piRNAs mapping to the Ae. aegypti tj gene contain U in their first position while 75.3% commenced with the 25 nt sequence 5' UAUUGACAACAGAAGUAACGAAUGA 3' with most variations being in the small number of additional ribonucleotides present at the 3' end.
After that they commenced with the lesson.
The tour commenced with four first-class fixtures against South Australia, Victoria, New South Wales and Queensland.
That was the year Rodriguez became A-Rod, hitting.358 and driving in 123 runs for the Seattle Mariners as a 21-year-old, while the Yankees' resurrection commenced with their first World Series title since 1978.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com