Sentence examples for combinations of forward from inspiring English sources

This study was designed to evaluate the effect of tyre inflation pressure and forward speed on tractor vibration in the paddy fields of Southern China by using a two-wheel-drive unsuspended tractor with different combinations of forward speed, tyre inflation pressure and soil moisture content.

We have applied various combinations of forward and inversion modeling of magnetic and gravity to well-constrained (petrophysics and drillholes) areas to characterize the 3D geometry and extent of the volcanic province and its crustal architecture, thereby adding to a better understanding of the emplacement mechanisms involved.

Cumulatively, the primers are 248-fold degenerate and have the potential to target a total of 68,124,672 unique combinations of forward and reverse primer binding sequences.

Combinations of forward primer 1 (F1: 5'-ATGTTCATCCTCAACCTGGCTGTC-3'), forward primer 2 (F2: 5'-TTGTGGACAACCTCATCACTGGGT-3'), forward primer 3 (F3: 5'-TTTTCACACTGGTGGCCATTGCTG-3') against a reverse primer (R1: 5'-ATGCGGGCGTACATGACCACGATGA-3') produced PCR products.

Pair-wise amplifications using combinations of forward and reverse primer modules were carried out in 15 µl PCR volumes containing 1X FailSafe PCR PreMix D (Epicentre Biotechnologies, Madison, WI), 6 ng of DNA, forward and reverse primer modules at 0.2 pmol⋅degeneracy−1⋅primer−1 (final conc)., and 1U Taq DNA polymerase (New England Biolabs, Beverly, MA).

The following 5'-3' primers were used to amplify G6PD (RefSeq ID: NM_000402): F GAGGCCGTGTACACCAAGAT, R ATCTGTTGCCGTAGGTCAGG, F GCAACGAGCTGGTGATCC, R AGAAGACGTCCAGGATGAGG. Because the four oligonucleotides were added at the same time in the reaction mix, four combinations of forward and reverse primers were possible, allowing the amplification of four different length fragments.

All camera locations were able to significantly improve LOS to 60% or greater while combinations of forward-facing and rear-facing cameras could improve LOS by as much as 80%.

Using a combination of forward planning and backward inference, an AI agent can work with a human operator as a team.

A new algorithm for steady-state fault diagnosis using the SDG model for the steady-state system, that uses a combination of forward- and backward-reasoning, is proposed.

Finally, optimization results indicated that the optimal vane blade featured an obvious combination of forward end-sweep, positive end-dihedral and end-bend.

Tesla's Autopilot system which uses a combination of forward radar, a forward-looking camera and 12 long-range ultrasonic sensors, and fast processors can handle straight-ahead predictable highway driving.