Sentence examples for colonization cycle from inspiring English sources

Most probably the extinctions involved all the haplotypes of a single island and not just the ancestral stock, and the colonization cycle was each time initiated from the nearest island that maintained derived haplotypes (often constituting back-colonization), thus moving the diversification age of the species in the island complex closer to the present.

In the case that extinction is indeed a major driving force of the distribution of lineages in the archipelago, then it makes sense to assume that after each extinction event, the colonization cycle would be initiated from a nearby island (back-colonization) that maintained derived haplotypes, thus moving the diversification age of the species in the Azores closer to the present (Fig.  8).

There were further colonization cycles within the Kerguelen Archipelago, namely the ones that lead to the colonization of the islands in the Morhiban Gulf.

The repeated re-colonization cycles would also explain why haplotype-rich islands (Table  2) are not inferred as the ancestral range of the species within the Azores.

Both E. coli and N. gonorrhoeae are Gram-negative human pathogens that show adaptation to, and are able to live in, anaerobic niches as part of their normal colonization-transmission cycles within the host.

Like most mucosal pathogens, infection of EHEC O157 H7 follows a common cycle: colonization at the mucosal sites, evasion of the host defense, proliferation and host damage[13].

It is plausible that different dispersal mechanisms facilitated inter-archipelago colonization during glaciation cycles.

A study of A. nerii on N. oleander in California clearly showed annual colonization and extinction cycles [11], corresponding with our own observations.

As a result, this species has a tendency for rapid colonization and extinction cycles [ 1, 7, 36].

A cycle of colonization of a food source likely begins when one to several dauer larvae discover a fruit or stem, exit the dauer stage and seed a growing population of up to 10 feeding nematodes at different life-cycle stages.

The sequence of β-tubulin (TUB2; GenBank # EU402967) was obtained by amplifying genomic DNA from strain SCOH1-5 with primers TubF (AACAACTGGCCAAGGGTCACTA) and TubR (GTCGAAGATTTGCTGGGTGAGCTC). 1 n/a = not applicable During the interaction between C. zeae-maydis and maize, two key aspects of the disease cycle are colonization of host tissue and the production of conidia for secondary inocula.