Sentence examples for code identity from inspiring English sources
Both evaluation methods are further detailed in the sections 'Experiment 1: ICD-10 code identity' and 'Experiment 2: Discharge summary overlap' respectively.
Rescue constructs were made insensitive to siRNA by replacing seven nucleotides while retaining coding identity (GACCTCATGGACTGTGGAAAT to GATTTAATGGATTGCGGTAAC).
Whereas the degree of coding identity will specify finer order for mosaic gene formation, we do not know how refinement is achieved for the other genes.
Data were managed using Microsoft Word applications, anonymised through coded identities.
Written informed consent was obtained from the participants prior to the commencement of the FGDs, during which their anonymity was maintained using coded identities.
Land is often code for identity and the Nuba see this as a fight for their cultural survival.
[Update 11/19, 11am PST: This article has been updated with info about Snapchat's new privacy policy and code regarding identity verification checks].
Claude never looked happy, never looked sad – he was just a blank slate, the perfect cypher upon which to code an identity unique to your play style.
We have shown that multivariate patterns in bilateral superior temporal and left somatomotor cortex code the identity of syllables irrespective of substantial changes in auditory form.
Finally, the minimum Hamming string distance of 3 between any two coding regions drastically diminishes the probability of random sequencing errors obfuscating the actual coding region identity.
Under cover of the tax code, the identities of donors are kept secret while they pay for attack ads against candidates, all the while claiming their main purpose is civic and nonpartisan.
