Your English writing platform
Discover LudwigSimilar(60)
Herein, a highly-sensitive microRNA (miRNA) detection strategy was developed by combining bio-bar-code assay (BBA) with catalytic hairpin assembly (CHA).
The cell cycle transcriptome that emerged implicates ∼40% of the 7,784 coding sequences assayed by microarray and is organized in two major transcriptional waves bounded by the commitment to DNA synthesis and cell cycle exit.
These early studies were based only on information from hypervariable region I (HV-I) in the mtDNA control region and a small number of diagnostic RFLPs in the coding region, assayed in samples from several populations of North Africa and Iberia.
Primers specific for EP2 (Qiagen Quantitect Primer Assay, code: Hs_PTGER2_1_SG; Qiagen) or EP4 receptors (Hs_PTGER4_2_SG) or, for calibration, primers for GAPDH (forward, ACCACAGTCCATGCCATCAC; reverse, TCCACCACCCTGTTGCTGTA) were used.
The MATLAB script is available for download as Source code 3. The assay was conducted in a room maintained at 80 90% relative humidity and 14°C to achieve low air temperatures within the gradient enclosure.
Human plasma concentrations of total GLP-1, GIP, insulin (INS), glucagon (GCG), and intact neutrotensin1 13 (NTS1–13) were determined using in-house radioimmunoassays (assay code: GLP-1total, 89390; GIPtotal, 80867-5; INS, 2004-3; GCG, 4305-8; NTS1–13, 3844-5) with I-labeled tracers and hormone-specific antiserum, recognizing COOH-terminal epitopes, as described previously (11, 16, 12a, 12b).
The assay codes can be found in Table 1.
Primers for crystallin α A (Cryaa) and crystallin γ f (Crygf) were purchased from Qiagen (Quantitect primer assay, codes 12954 and 12969 respectively).
The assay codes of the primers are shown in Table 1.
NGS sequencing and data processing: exome capture from CT26 and BALB/cJ mice were sequenced in triplicate using the Agilent Sure-Select solution-based mouse protein coding exome capture assay.
From this effort, 88 of the initial 126 proteins were confirmed peroxisomal by a published direct experimental assay (evidence code 'Inferred from Direct Assay, IDAssay
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com