The method described here is based on cocktails of forward and reverse oligonucleotides for PCR which are designed to identify and index the genetic diversity known to occur at a target region in any species of interest.
The primers used in this study to amplify COI included a primer cocktail of two forward primers: LepF1 - ATTCAACCAATCATAAAGATATTGG, LCO1490 - GGTCAACAAATCATAAAGATATTGG; and two reverse primers: LepR1 - TAAACTTCTGGATGTCCAAAAAATCA, and HCO2198 – TAAACTTCAGGGTGACCAAAAAATCA [ 58, 59], for full-length barcodes.
Cocktail, cocktail, cocktail, cocktail......
Five additional cycles were added when using primer cocktail C_tRWF_t1 (mix of forward primers given in Table 1).
Early estimates had patients visiting four times per year, but the people who were sickest and least able to be helped by a cocktail of anti-retroviral drugs came forward first.
A cocktail of two tRNA-W forward primers coupled with a standard reverse primer amplifies COI for most hexapods, allowing characterization of the standard barcode primer binding region in COI 5' as well as the barcode segment.
PCR reaction cocktail contained 20 ng template DNA, 0.2 μM each of forward and reverse primers, 2 μL 10 × PCR reaction buffer, 2 mM dNTP mix, 2 mM MgCl2, 0.5 U Taq DNA polymerase (Promega), plus adding sterile water to total volume to 20 μL.
Briefly, 2 µl of each RT reaction were mixed with 23 µl of a PCR cocktail containing 1X PCR Buffer, 1.5 mM MgCl2, 1 unit of Taq polymerase, 10 mM dNTPS, 20 pmols of forward and reverse primers.
A step forward Inhaling glue or injecting a cocktail of cold and flu medicines are common ways of taking drugs among homeless young people.
PCR assays for amplifying SSR markers were performed in a cocktail of 10 μL containing 20 ng of DNA, 0.25 μM forward primer, 0.25 μM reverse primer, 0.25 mM dNTPs, 2.5 mM MgCl2, and 0.65 unit DNA Taq polymerase.
