Sentence examples for cluster were used from inspiring English sources
Thresholded images for each identified cluster were used as ROIs in the following ROI-based MVPA.
The most likely members of the cluster were used in the determination of the astrophysical parameters of the cluster.
Also note that when t = ∞, all GMMs in a cluster were used to generate compressed templates, where the existence of outliers degraded the accuracy performance significantly.
In addition, two other primer pairs PRBnrs3104 5′…tggagaaatatcactgaacaatgc and PRBnrs3943 5′…acgtttagtttcagttctttcacc for detection of the nrs gene cluster and PRBptn6179 5′gatagaagtattagcctggaagca and PRBptn7000 5′…tggaggaggtaacaattatgactc for detection of the pzn (plantazolicin) gene cluster were used.
Non-bootstrapped phylogenetic trees for each protein type in the initial seed database were constructed and representatives from each obtained phylogenetic cluster were used to iteratively search the Integrated Microbial Genome (IMG) database version 2.4 [38], last updated December 2007, using BLASTp [39].
Lipopolysaccharides purified from 3 uterine E. coli isolates per MLST cluster were used at a concentration of 1 µg/ml in culture media to challenge endometrial epithelial or stromal cells in 24-well plates, using untreated media or media containing 1 µg/ml of commercially ultrapurified LPS from E. coli O111 B4 as negative and positive controls, respectively.
Cluster is used to build small private spaces with friends.
Training data from only one specific cluster is used to train the tree for this cluster.
The sequence of the predominant read of each cluster was used for the following analyses.
Otherwise (rare situation), all sequences in that cluster are used.
