Sentence examples for clones were done from inspiring English sources

Isolation of stably expressing clones were done by limiting dilution and selection with IL2 (25 U/ml) and hygromycin B (800 mg/ml) for 14 days and cells surviving this treatment were cloned and assessed for Bcl-2 and Stat-5 expressions by Western blot analysis.

Transformation and patching clones were done by DK and PN.

The procedures for all four clones were done in parallel.

Germline and somatic cell clones were done as described previously (Shcherbata et al, 2004, 2007) using hsFlp/FRT system for mitotic recombination.

Screening for positive clones was done with live cell surface immunofluorescent staining.

A kinetic study of the productivity of these clones was done to evaluate the secreted recombinant cTA12 concentration.

Additional 5' sequencing of these 76 non-expressing clones was done to check for errors in their DNA sequence.

Selection of plasmid constructions in E. coli clones was done by adding ampicillin as described above and correct fusions were verified by sequencing.

For the second vector, Pogostick-up-2, DsRed was cloned into SpeI of Pogostick and PCR amplification and sequencing (of picked clones) was done with primers HSP2-F (TCGCAGTCGGCTGATCTGTGTG; intron-anchored) and HSP2-R (TCGACGGATCCCCGACACCA).

Sequencing of selected clones was done using automatic DNA sequencer.

The activity confirmation in selected clones was done in ø 9-cm Petri dishes.