Sentence examples for clone product from inspiring English sources

Each clone (product and entry) can be used as a new entry-clone (Marquardt et al. 2014).

A plasmid for expression of HA-tagged Malectin was prepared by amplifying the protein coding sequence from the full-length cDNA clone, product IRAUp969B111D (Imagenes) with the primers CACCGAATTCCCACCATGCTGGGAGCCTGGGC and CCCACCCTCGAGTCA CAACCGGCAGAGGCAGAA.

Monoclonal antibodies (mAbs): Specificity Clone Product # Isotype Source Anti-β1 integrin P4C10 MAB1987 IgG1 Chemicon Int.

The antigenicity of clone product was analyzed by immunoprecipitation using sera from all 39 BD patients in parallel with normal controls and control sera from Lupus and Sjögren syndrome patients.

Specificity Clone Product # Isotype Source Anti-p21CIP1 pAb PC55 IgG Oncogene Anti-p27KIP1mAb F-8 SC1641 IgG1 Santa Cruz Anti-Actin mAb JLA20 Supernatant IgM Developmental Studies Hybridoma Bank HRP-conjugated goat anti-mouse IgG.

But, unexpectedly, analysis of the smallest amplified sequence revealed the 5' end of the pap gene which is located 7 or 3 nts upstream of the putative AUG, depending on the clone product.

The cloning product was inserted into pMD-T vector and then sequenced.

That report said the risks of animal cruelty were grave enough to keep cloned products off the European market.

Current commercial cloning products are not robust enough to support the assembly of very large or very small genetic elements or a combination of both.

We cloned products that contained sequences of more than one locus.

Cloned products were then sequenced with an Applied Biosystems 3130xl Genetic Analyzer.