One assistant under whose care the gift-giving resided was Anita Colby, and for every year she had files fat with ads cut out of magazines, entries clipped from catalogs, drawings of gloves, robes or jewels that Selznick had just imagined, to say nothing of the lists of gift suggestions for all the Selznicks and their retainers.
Thomas Howell) -- holed up in a basement room with a blowup sex doll, a homemade collage of young women clipped from catalogs, and a shelf full of books with titles like "Pain" -- we're queasily awaiting the catalyst that will unleash his self-evident propensity for mayhem.
For instance, a video clip, almost four million catalogs and online ads for Sharper Image feature one of the most famous recent Super Bowl celebrities, Betty White, the star of a popular ad for Snickers in Super Bowl XLIV three years ago.
An aspirant judo instructor turned artist in 1955, Yves Klein died in 1962 of a heart attack at 34. "A Career Survey" at L & M Arts has brought together 32 monochrome and other painted works, along with charming video clips and a catalog of Klein's brief but eventful career.
The flashy video site, which doesn't bother negotiating with copyright holders to show its vast catalog of clips, can maneuver much more nimbly than boring old AOL, which pays lawyers a lot of money to worry about that kind of thing.
"We made a catalog of music clips — whale sounds, Radiohead, weird screeching of metal — and I memorized them.
Mice were genotyped for K14-CreERtam using the following primers: forward, CGATGCAACGAGTGATGAGGTTC; reverse, GCACGTTCACCGGCATCAAC. Mice 6 8 weeks of age in telogen were treated topically to clipped skin with 4OHT (Sigma catalog # T176-50MG) 1.0 mg/day for days 1 5 and again on days 13 17 dissolved in 95% ethanol (1.0 mg/200 ul) and skin collected for IHC on day 21.
A growing catalog of genome-wide CLIP studies continues to generate fascinating insights into the diverse functions of RNA-binding proteins.
The app has been in private testing before today's public debut, and now has a catalog of thousands of clips available for use.
According to Visible Measures, a company that computes viewings of Internet videos, her catalog of on-online clips was watched over 310 million times during 2009.
