Sentence examples for chore sequence from inspiring English sources

Exact(2)

Thus, an additional candidate ChoRE sequence on the Txnip gene promoter was identified; for convenience, we dubbed the previously identified ChoRE (∼80 bp) as ChoRE-a and the newly identified ChoRE (∼170 bp) as ChoRE-b (Figure 2C).

In fish (fugu, tetraodon, zebrafish and medaka) Txnip promoters, the nucleotide sequences at the ChoRE-a position actually deviate from a canonical ChoRE; on the contrary, the fish ChoRE-b better mimics a canonical ChoRE sequence than does human ChoRE-b (Figure S4).

Similar(58)

We aligned the Txnip promoter sequences and found that the two ChoRE sequences, a CCAAT box, an inverted CCAAT box and a forkhead box O (FOXO) binding site were all well conserved among these species (Figure S2).

We conclude that both the earlier defined ChoRE and nucleotide sequences near the −170 positions are critical for the induction of Txnip expression by adenosine-containing molecules.

Our view is that the ChoRE-b nucleotide sequences should be GAGCACACCGTGTCCACGCG, especially when the fish Txnip promoters were considered (Figure S4).

The sequences of both the ChoRE sites on the frog Txnip promoter are moderately degenerate thus lying in between the fishes and mammals (Figure S2, S3, and S4).

We examined the Txnip promoter sequences (184 63 bp) and found that, apart from the known ChoRE (CACGAGggcagCACGAG; ∼80 bp upstream of the transcription start site), the nucleotide sequences around the −170 region (CACACCgtgtcCACGCG; Figure 2C) mimicked a degenerate ChoRE, which is defined as two E-boxes (CACGTG) separated by 5 nucleotides [38].

Each album has good songs, but each album also has some fatal flaw in sequencing or pacing which renders listening a chore.

Even the smallest act can lead to a huge narrative twist that would otherwise be missed, and a normally banal chore can carry as much tension as the many stand-out fight sequences.

This suggests that the earlier defined ChoRE alone cannot support optimal induction of Txnip expression by glucose, and that some nucleotide sequences upstream of this ChoRE is also critical for the responsiveness of Txnip promoter to glucose.

The nucleotide sequences between two ChoREs contain a CCAAT box, an inverted CCAAT box and a FOXO binding site (Figure 2C); these three sites are highly conserved in Txnip promoters from different species (Figure S2).

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: