Your English writing platform
Discover LudwigExact(3)
Nonetheless, we found that for both left and right LFPs (bottom), the largest changes typically occurred slightly later, but still within the early phase of the behavioral choice (note, LFPs increase downwards).
This is probably because megablast reports non-overlapping matches, which is a matter of choice – note that the above sequence is a repeat of the 5-letter word GTGTT the query TGAATTCGGTCTTGCCTTGAACACA found a spurious perfect match on the genomic sequence NGAATTCGGTCTTGCCTTGAACACA. Except for these minor problems, all three tools reported the same hits.
If you wish to change your selected choice, note that fees already paid are not applied to another selection.
Similar(57)
Now, with at least five major browsers, there is more choice, noted Gal.
The university has defended the choice, noting Augustine's record of achievement as an analyst of tough technical and scientific questions.
The OSCE's Office for Democratic Institutions and Human Rights ODIHRR) said "this was an election without a real choice", noting that at least some of Mr Rakhmon's "significant advantage" was due to "ballot-box stuffing".
She told me that Mr. Powell, with his reportorial skills and deep knowledge of New York and New Jersey, was the right choice, noting that he managed to get several members of a grand jury to speak to him — not an easy feat.
Austro said in an interview Monday that he was immediately struck by something unusual about the choice, noting that every official is graded by league observers following each game worked, with every call made being deemed correct or incorrect.
Filling the top post at GCHQ – which commands the lion's share of the UK's vast security budget, to the extent that MI5 and MI6 are routinely referred to as "the tiddlers" – is clearly a big choice, notes Aldrich, but "whether the job is big enough for [Farr] is the question.
Some panel scientists said Mr. Bush might end up regretting the choice, noting that Dr. Pachauri has repeatedly criticized the president for not acting more aggressively to cut emissions from the United States, which is the largest source of heat-trapping gases.
He emphasises his concerns for the elderly and says he advocates for people to be given information and a choice, noting the shocking statistics for suicide among people aged over 80. Nitschke will on Thursday hold Australia's first conference on rational suicide in Melbourne and has been given strict rules by the Victorian state library in return for hosting it.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com