Your English writing platform
Discover LudwigExact(2)
Other experts have written about means to enrich chemical libraries for scaffolds that are more chemically appropriate to penetrate into and not get effluxed from bacteria [ 19].
In something like seven minutes, Maher expressed fear or hypercriticism of sugar ("really the enemy"), pasta, wheat, yeast ("yeast is bad") and dairy ("not chemically appropriate").
Similar(58)
DNA oligonucleotides were chemically synthesized, and appropriate restriction sites were introduced via PCR amplification with the following primers: CATCGGTACCATGGCCGGGACCGTGCG (Forward) and TCGACTCGAGCACCAGGAAGAAGAAGCACACCACCG (Reverse).
They challenge the public or private right to pollute the environment, to systematically destroy predatory animals, to spread chemical pesticides indiscriminately, to meddle chemically with food and water, to appropriate without hindrance space and surface for technological and military ends".
Chemically crosslinked products are less appropriate for skin substitutes.
To capture keratinase on these surfaces, appropriate tags can chemically modify keratinase.
Instead, angiogenic small molecules which are chemically stable can be more appropriate for the harsh conditions of the oral cavity.
Conventionally, thin films of these perovskites are fabricated by spin coating the chemically synthesized components using an appropriate solvent.
The edges of the AGNRs are chemically more active and they can accommodate appropriate dopants to obtain different electronic properties having the same geometrical structure of the ribbon.
The first step is the generation, by gene targeting, of an acceptor allele containing the appropriate recombinase recognition sites and chemically selectable markers.
Chemicals: Keep pets off chemically treated lawns.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com