Sentence examples similar to checking presence from inspiring English sources

We checked presence of BOP on each tooth while measuring the PPDs.

To check presence of anthraquinones, 0.5g of the plant extract was boiled with 3mL of 1% HCl and filtered.

The following combinations of the primers were used: to check presence of distal loxP sites LF/LR; to check Cre mediated excision of the locus LF/ER; to check Flp mediated excision of Neomycin cassette EF/ER.

A thruster failure is shown to be detectable simply checking the presence of any deviation of the observed sliding surfaces.

Genotyping by PCR was performed by checking the presence of GFP using the following oligonucleotide primers: 5'andAGCAGAACACCCCCATCG3' and 5'CGGTCACGAACTCCAGCAGGA3'.

After checking the presence of multicollinearity among predictor variables, interaction analysis was performed.

The genes were confirmed as RRs or HKs by checking the presence of typical conserved domains.

SurGasp1 F1 animals were genotyped by checking the presence of the CMV sequence using specific primers (fwdU2: AAGTACGCCCCCTATTGACG and revR1: CCAGAGGTTGGGGTTCATGT).

He checked the presence and location of his 18 students against a seating chart.

The system also checks the presence of rubbish outside the bin.

We checked the presence of Pb1 in Miyazakimochi and four BC3F2 individuals by reverse-transcriptase polymerase chain reaction (RT-PCR).