Your English writing platform
Discover LudwigThe phrase "check loss" is correct and can be used in written English
It is often used when discussing financial or business matters, such as tracking expenses or managing profits. Example: "We need to monitor our expenses closely to check loss and ensure our company remains profitable."
Exact(1)
Moreover, due to the robustness of the check loss function to outliers in the finite samples, our proposed variable selection method is more robust than the ones based on the least squares criterion.
Similar(59)
For the Knicks, it was a reality-check loss.
Check the loss of market share at any cost.
All the designed mutant nucleotide sequences were re-analysed in Match 1.0 Public to check for loss of the specific transcription factor binding site and that no new binding sites were generated.
To check for loss of proteins in the RNA-depleted samples, the chloroform phase and RNA-containing aqueous phase were run for 2D-PAGE analysis.
Twelve colonies were picked and screened by PCR to check for loss of the selection cassette (Primers RyR2f: GGGGAGTTGGCTGCTGAGAA; RyR2r: CGGGCACACACTCACCACCAA).
Selected antibiotic resistance colonies were then grown on LB broth Km at 43°C for 24 h and then spread on LB agar Km or Amp at 37°C to check the loss of the helper plasmid.
Not only did he fail to net much cotton but also he was checked with loss on April 8 at Sabine Cross Roads, Louisiana, and forced to retreat.
Vetiver grass (V. nigritiana) planted at intervals across slopes could check erosion losses and allow meaningful cultivation of the alleys between vetiver hedgerows.
Example 6: Here, the homogeneity is checked, and loss (or preservation) is examined for the three techniques M1, M2, and M3 while being applied to "Lena".
The 5-FOA-resistant colonies were picked out and checked for loss of URA3 by replica plating on SC-Ura− plates.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com