Sentence examples for changed to introduce from inspiring English sources

Exact(4)

In response to a court of appeal ruling, this was changed to introduce a filtering system.

When positive traits were presented first, the participants rated the person more favourably; when the order was changed to introduce the negative traits first, the same person was rated less favourably.

Contrary to previous attempts where the pathology routine had to be changed to introduce either whole-mount tissue sections or parallel consecutive slicing [27], the method outlined in this study affects the routine pathology workflow with the addition of one extra step, the insertion of the fiducial markers.

The sequences of primers used for generating Flag-Sox2-HMG expression plasmid are listed below: Flag-Sox2-HMG-U: GAACAGCCCGGACCGCGTCAAG Flag-Sox2-HMG-L: GCGGCTTCCGGTCCGTCTCCATC Bold, italicized, and underlined sequences in Flag-Sox2-HMG-L primer refers to bases changed to introduce an RsrII restriction site.

Similar(56)

The U.S.G.A. has made these changes to introduce more risk-reward options for players, rewarding them for well-played strokes and penalizing them for bad shots.

The authors believed that the format may also allow future changes to introduce better, more efficient diagnostic information for the test taker.

Canada has experienced pressure for legislative change to introduce DTCA since the mid 1990's.

Below, we describe how classroom instruction may use DNA sequences and teaching for conceptual change to introduce students to natural selection.

She has changed her discourse to introduce social issues and was noticeably softer on immigration.

America changed its constitution to introduce an income tax in 1913.

32 The model changes required to introduce the SSP are minor.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: