Sentence examples similar to change of marker from inspiring English sources

Similar(60)

Nineteen pregnant women in their first pregnancy trimester were asked to participate in this experiment as part of a larger study concerning the longitudinal changes of marker levels in blood.

We also collected the changes of markers including C-reactive protein, white blood cell count, SIRS, and SOFA score.

Percent changes of markers are shown in Table 2. Analysis showed significant difference in percent changes regarding d-dimer level in the two groups.

TTATAATACAGTTTTCCAGGTATCGTTTGAACACGG HIS3_O_r Cloning of HIS3-expression cassette, for change of auxotrophic marker.

Immunofluorescence staining showed the change of each marker.

*One-sample Student's t test of the change of each marker in the overall study sample.

A 20% change of tumor marker levels while on chemotherapy was used to define biological response (decrease) or progression (increase).

In this study, we found that fHRT shows a change of the marker component profile compared to HRT.

The presence of the negative control in each qPCR run is fundamental for the final calculation of copy number change of each marker.

The change of differentiated marker (such as SM α-actin and calponin) expression level in VSMCs is a useful paradigm for analysis of VSMCs phenotypic transition.

Traditionally, this involved finding changed expression of marker genes, or specific gene mutations, i.e. focusing on the nodes in the network.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: