Your English writing platform
Discover LudwigExact(15)
But it surely needs a more certain signature than prettiness.
A yellowish wave along the forehead stands in for a certain signature comb-over: Trump's.
House-made sweet and savory treats, artisanal beverages and certain signature items from the restaurant will also be available.
No matter which city it inhabits, a branch of L'Atelier has certain signature touches as identifying and ineluctable as a blue box at Tiffany's.
If you pay attention, you can begin to identify various regions by certain signature motifs — Mongolia by its horses, or Arizona by its round, topiaried trees in the middle of its gravel front yards.
Players will be able to unlock 100 superhero characters to supplement the main cast: Deadpool, Captain America and Hawkeye are on the list, no doubt exhibiting certain signature powers of their namesakes.
Similar(45)
Algae leave certain signatures of organic compounds and isotopes of carbon and nitrogen; bacteria leave different signatures.
What I love is this idea of a wardrobe," says Phoebe Philo, "the idea that we're establishing certain signatures and updating them, that a change in colour or fabric is enough.
But Jeffrey C. Feldman, executive director of the Brooklyn Democratic Party, said Mr. Martinez's campaign interchanged addresses for Hispanic residents with the same names to try to validate certain signatures and allowed Mr. Martinez's father to sign as the witness on petitions that had been gathered by others.
Similarly, certain signatures 5'TAAAGCTCTGTTGTTAGGGAAGAACAAGT 3' were shared only between B. subtilis and B. pumilus.
Similarly, when dissecting several reported gene signatures Wirapati et al. found that when using only a subset of signature genes associated with proliferation, performance was identical or even improved for certain signatures [22].
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com