Sentence examples for cells of individual from inspiring English sources

The user is able to sort the table according to the different dimensions and color the cells of individual dimensions according to its values.

Genomic DNA was isolated from cells of individual tumors, of which tumor cells constitute at least 90%, and used for PCR-mediated amplification of the PEST domain of the Notch1 gene with the following primers: TACCAGGGCCTGCCCAACAC and GCCTCTGGAATGTGGGTGAT.

Briefly, SP-A+/+ and SP-A−/−mice were anaesthetized using isofluorane and inoculated intranasally with 1×107 cells of individual STM pools of 72 mutants in 50 µl of phosphate buffered saline buffer.

HOMA- β is frequently used to evaluate the function of islet beta cells of individual indicators.

However, intensity of Bid stain varied from biopsy to biopsy and within tumour cells of individual biopsy sections.

Human monocytes were isolated from peripheral blood mononuclear cells of individual healthy human blood donors as described previously (Foxwell et al., 1998; Sacre et al., 2007).

To investigate whether corneal epithelial cells of individuals with lattice corneal dystrophy (LCD) possess an intrinsic defect.

Fetal tissue homozygous for the common FD-causing mutation and peripheral blood cells of individuals with FD have reduced MAO A mRNA levels.

We have previously shown that human T-cell receptor (TCR) αβ-chains specific for allergen-derived epitopes confer allergen specificity on peripheral blood T cells of individuals with and without allergy.

Furthermore, this peptide exhibited promiscuity in that it interacted with T cells of individuals with several different MHC genotypes [33].

Interestingly, levels of EEF1A2 transcripts were increased to a lesser extent in plasma cells of individuals with MGUS, a consistent precursor to MM [38], than in primary MM.