Sentence examples for cell existence from inspiring English sources

To determine whether features of human brain development with oRG and IP cell existence were recapitulated in cerebral organoids, we analyzed the organoids on day 65 (Fig. 1E).

Such a membrane structure characteristic of archaea is already optimal for cell existence in extremely high temperatures and pressures.

This concept is tightly linked to two key conjectures on evolution of cells: existence of a complex, precellular, compartmentalized but extensively mixing and recombining pool of genes, and origin of the eukaryotic cell by archaeo-bacterial fusion.

The same graft tissues had similar number of CD4+ positive cells and mast cells suggesting existence of CD4+ positive mast cells.

Clue cells are unusual cells whose existence in the sample means that bacterial vaginosis may be present.

Stanford University School of Medicine researchers have unraveled the workings of an important type of immune cell whose existence was unknown just a few years ago.

Revelation of the cell's existence in late 2011 shocked Germans and raised questions about how security authorities could have failed for the better part of a decade to stop the group from killing minorities.

Authorities have no evidence linking Ms. Zschäpe to any of the murders, but they say she played an integral role in renting apartments, managing money, and ensuring the terror cell's existence.

Hence, to facilitate the transfer of DNA molecules into a cell, the existence of a vector is necessary [6, 7].

The price of collective organization, however, is that the cell's existence becomes submitted to the requirements of the larger entity.

Distinctive features include large amorphous cells, an existence restricted to the host cell cytoplasm, a low GC content, a recoding of UGA from stop to tryptophan, and the unique 16S rDNA sequence CTAGTTATTAAATTAAAAATAAAATTTAGTAACG (positions 826 858, Escherichia coli numbering).