Sentence examples for cassette for from inspiring English sources
The phrase 'cassette for' is correct and can be used in written English
It is usually used to describe something related to a cassette, or to describe the purpose of a cassette. For example, "I recently bought a cassette for my old car stereo."
I saw the album on cassette for $4.99 at a truck stop on Interstate 15, surprisingly.
He even created a prequel in the form of "an agitprop video game" cassette for beloved British microcomputer the ZX Spectrum.
For our full day at the park, Alec and I bought an auto-tour tape cassette for $10 that includes yet another map of the battlefield.
But in London in the early 1970s, a conceptual artist named William Furlong began harnessing the cassette for his unlikely purposes in the visual arts.
"I was working with a band that was able to afford the price of a cassette for every show," he said with a laugh.
These days, that same kid can get the cassette for nothing.
TTATAATACAGTTTTCCAGGTATCGTTTGAACACGG HIS3_O_r Cloning of HIS3-expression cassette, for change of auxotrophic marker.
Lane M, 1 kb DNA ladder; lane 1, the amplified disruption cassette for DH domain of PKS module 12 (1.3 kb); lane 2, the amplified disruption cassette for FkbH gene (1.3 kb). Figure S4.
The baculoviruses are engineered by inserting a mammalian expression cassette for delivering foreign genes in mammalian cells.
This study documents the use of an IMAC cassette for the purification of N-terminally tagged recombinant proteins.
Phage NL1.1 was engineered to include a mammalian expression cassette for a reporter gene within its genome.
