Sentence examples for calculated consensus from inspiring English sources

Above all, it delivers a terrifyingly calculated consensus storytelling, an artificial universality that is achieved, in part, through express religious references.

Residues shared by at least 70% of the calculated consensus sequences are shown in boldface.

We also applied consensus hierarchical clustering to assess the stability of the clustering results by multiple runs of the clustering algorithm on resampled data [ 32, 33], and calculated consensus index as reported previously [ 33].

Based on the Rab records retrieved from the PDB database [ 127] we calculated consensuses of secondary structure for Rab7a and Rab9 proteins.

Based on these calculated consensuses we designed the primers for the transcription factor reporters which included degenerate sites and cloned them immediately downstream of a synthetic σ70 derivative promoter called synRNAP-σ70 (AATAATTCTTGAAATTTATGCTTCCGGCTCGTATTTTACGTGCAATT).

We discuss three issues of the LMASs under a generalized linear protocol: 1) to find criteria of consensus convergence; 2) to calculate consensus function; 3) to design gain matrices in the linear consensus protocol.

For this purpose, we used the online RNAalifold software (http://mobyle.pasteur.fr/cgi-bin/portal.py, with the MFE (minimum free energy) fold algorithm) that calculates consensus secondary structures for a set of aligned RNAs [66].

To calculate consensus sequences, the COnsensus Biasing By Locally Embedding Residues method was applied (COBBLER).

The resulting bootstrap trees were read into Treefinder version October 2008 [ 62, 63] to obtain the bootstrap values, as GARLI-PART does not calculate consensus trees.

Joinmap software calculates consensus map by a regression algorithm only, while Carthagene allows one to work with the maximum likelihood even for integrated datasets, coupled with effective marker order refining procedures.

Using the summarization approach introduced in Section 2.3, we therefore calculate consensus statistics for each transcript and KEGG pathway using each of the considered coresponse measures or their combination.