Staining was carried out using the Envision Detection System (Dako) according to the manufacturer's instructions followed by visualisation with diaminobenzidine (DAB) for 10 min.
Samples were separated on a 5%% (w/v) native polyacrylamide gel in 0.5 × TBE for 4 h at 100 V followed by visualisation with the Odyssey infrared imager (Licor Biosciences).
Unbound antibody was removed by washing, followed by visualisation with nitroblue tetrazolium chloride/5-bromo-4-chloro-3-indolyl phosphate (Roche, Mannheim, Germany) in the dark at room temperature for 18 h.
Signal was detected with 1 : 4000 dilution of appropriate HRP-conjugated secondary antibodies (all from Invitrogen Molecular Probes, Carlsbad, CA, USA) followed by visualisation with the enhanced chemiluminescence reagent (Amersham Biosciences, Little Chalfont, UK).
Slides were then washed and incubated with EnVision + Dual Link reagent (DAKO, Glostrup, Denmark) for 30 min followed by visualisation with the peroxidase substrate diaminobenzidine (DAB) (DAKO, Glostrup, Denmark).
Staining with the secondary antibody and Hoechst was performed as described before, followed by visualisation under a fluorescence microscope.
RNA quality was assessed by visualisation on a denaturing formaldehyde RNA gel (protocol recommended by Qiagen) using ethidium bromide staining.
RBC binding to transferrin fibres was studied by incubating fresh human RBCs with a 4-day-old transferrin solution, followed by visualisation under an optical microscope.
Primers representing previously annotated (5' GTGAGGAGGTTTTCTTGGAAG 3') and novel (5' CTTCTAGGGAATTGCGACTG 3') exons were used with a common reverse primer (5' CTGGGAAATACATCAGCTGG 3') to amplify products by RT-PCR followed by visualisation on an agarose gel and sequencing.
Application of the KSF opens the clinical arena of [18F]FLT-PET imaging in upper gastrointestinal tumours by improving tumour visualisation with the hope of improving patient outcome by improved detection and differentiation of both primary lesions and metastases.
